Answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
umka2103 [35]
1 year ago
4

Why must most amphibians start their life in water

Biology
2 answers:
lions [1.4K]1 year ago
7 0

Answer:

Frogs and toads live on land but require water in which to lay their eggs. ... Frogs live on both land and in water and require habitats near ponds, swamps or other damp places as death occurs if their skins dry out. Frogs have permeable skins allowing them to both breathe and drink through their skins.

Explanation:

ozzi1 year ago
3 0

Answer:

Because it is what amphibians are adapted to live in. They are adapted to wetlands. it is where they eat, mate, sleep, etc...

Explanation:

You might be interested in
What is the role of tRNA during translation?
kotykmax [81]

Answer:

Role of tRNA in translation

tRNA is responsible for bringing amino acids to to developing chain amino acids on sequence of mRNA through ribosomes.

Explanation:

6 0
1 year ago
What do restriction enzymes do?
Ludmilka [50]

Answer:

A

Explanation:

Restriction enzymes cut the strand of DNA at specific sites.

5 0
1 year ago
Read 2 more answers
Which explanation justifies why the theory of evolution is a theory and not a law?
mel-nik [20]
I think that it is the last answer listed. The first three that are listed are true about the theory of evolution but they do not answer the question.
8 0
1 year ago
Which ideas did you include in your answer
Wittaler [7]
I think all three ideas should be selected since they were all in the blue box so it seems like it’s included
4 0
1 year ago
The messages that scientists are sending into space are directed at intelligent alien life. Do
kykrilka [37]

Answer:

I think there is life beyond earth. Actually there most definently is. I think in  a way it could be limiting. It's the fcat that the ones out there may not even be able to receive the message as fast as we please. Who knows, it could be years, decades, maybe centuries before they make actual contact with us. Then again, maybe they already have. But, the way this could affect the study is the fact that (I doubt it) but maybe a message could be sent the wrong way, or they misinterpret it. That's the only think I can get off. Anyway, this can also depend on how much funding is going into space. This also brings up the question, "How much do we know about our own planet?

8 0
1 year ago
Other questions:
  • How are all the species in a food chain similar to links in a metal chain?
    5·2 answers
  • Sponges are in the phylum
    12·1 answer
  • PLEASE HELP ASAP
    6·2 answers
  • Please help
    13·1 answer
  • A runner is running the 60-meter dash, which is an oxygen-deficient race. What type of energy is the runner's body using to powe
    12·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Microbes that normally colonize the mouth must be resistant to
    6·1 answer
  • If the population of rabbits in this ecosystem decreased dramatically because of certain environmental changes, which organisms’
    5·1 answer
  • . Si el átomo contiene electrones que son partículas con carga eléctrica negativa, ¿por qué el átomo no tiene carga
    10·2 answers
  • Discuss how the environmental pressures are different in the local environment compared with its native environment.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!